domingo, 1 de junio de 2008

Noche

Hace unas noches tuve una noche terribilísima. No, no estaba peda, no, no dormí en una cama de clavos, no, no comí demasiado. Había un no se qué que me puso los pelos de punta, un noséqué, válgame.

A las 2 de la mañana me fui a dormir y empezó:

ti ti....... pip, ti...

Creí que era una gotera o algo así, pero nah, se escuchaba debajo de mi tocador, jaja, tocador, si, de señorita, con espejo y todo. Decidí no hacer caso, seguramente sería un bichito y traté de dormir. El chingado bichito se transportó en chinga abajo de mi cama y eso sí hizo que abriera los ojos como platos. Santa Madre!!!!

Y dale:

ti ti, pip..... titititi, pipipi..... ti ti

Y como me di cuenta de que creo que ningún bicho le hace así, me asusté más, porque seguía dando vueltas debajo de mi cama, y en cualquier momento podría subir y descuartizarme, a mi, el amor de su vida, y entonces quién sería el amor de su vida?

Yo a punto del patatus encendí la lámpara y me asomé ligeramente para ver qué había, no me atreví a asomarme del todo, tsss, toda cobarde.
Y zas, en chinga me levanté, me puse mis sandalias, no fuera que saliera el noséqué y me comiera los pies.... Fue entonces que me fui a dormir con mi mami.....

Y dormir con mi mami es horrible. No abre la ventana y hace mucho calor, duerme con mil cobijas encima y.... ronca. Pero eso no es lo peor, noooo, mi madre odia la tecnología, le chocan los celulares y los despertadores decentes, así que tiene un relojote de cuerda de los sesentas y otro más pequeño, también de cuarda. Lo más extraño es que cada noche pone los dos, los dos!!

Dice que por si no funciona uno pues que tiene el otro. ...? entonces yo no sé cómo le hace, pero los desgraciados están tactactactactacatacatacataca, espantoso, yo no puedo dormir con un ruidito, necesito silencio de pueblo, así que con la almohada en la cabeza y el calor nomás no podía dormir.

Lo peor fue a las 4 de la mañana, que yo seguía despierta, mi madrecita santa se despertó, me pone las pies encima y empieza a platicar conmigo.... Claro, como ella se durmió a las 11 pues ya estaba como lechuga....

"Ay cata, ayer mi jefe blah blah blah, y me sigue jodiendo blah blah blah, pero voy a seguir yendo al diplomado blah blah blah"

"Sí..... aja...."

"Y cómo vas a salir de la escuela? .... ¿Por qué tienes que hacer extraordinarios? .... A ver si te vas a quedar otro año en esa prepa tan fea, te voy a quitar el internet o te vas de niñera a Francia, yo no te voy a consentir...."

".....seeee, aja......"

"Ay, el viernes hay un concierto de Jazz en el claustro de Sor Juana blah blah blah.... lo anunció Germán Palomares blah blah blah....."

".... ah si?......"

Y luego lo peor. Se le salieron las lágrimas.

".... Ay, es que no sé qué me pasa, no puedo meter bien el cluch y las velocidades, em pongo muy nerviosa, no sé qué pasa, se atora la palanca..... blah blah, anoche estuve practicando, primer, segunda, tercera, cuarta, primera, segunda, tercera, cuarta, primera segunda, tercera, cuarta.... "

".... Tranquila mami, yo sé que podrás, sólo practica más...."

Entonces huí. No sé que´pasó con el noséqué pero me acosté en mi camita querida y me quedé jetona enseguida, quién me manda.....

Nunca se duerman con sus mamases, molestan mucho.

6 comentarios:

sirako dijo...

jaja que buen post, te lo vendo.



y yo por eso nunca duermo.

carajo dijo...

jaja

deberías rentarle tu mamá a estudiantes que necesitan permanecer en vela

te puedes hacer rica!

Falcon dijo...

Jajajaja quien te manda, hubieras dormido con el no se que, que era menos molesto

Nepo dijo...

¿Y qué tal si era Ernest el vampiro o el duede mágico titi pipi que mágicamente se lleva tu pipi para venderla y quiso dejar tu parte? O mejor aún ¿qué tal si era un diablito loco buscando una guitarra, que bailaba y cantaba, se rascaba y gritaba y decía dónde diablos la guitarra se quedó? eh eh, pudiste tener una serenata pero no, decidiste irte a no dormir con tu maye. Chale me hace falta dormir.

KDM dijo...

Justo anoche anunciaron en la tele que se escapó del CERESO el 'asesino del titipipipi', cuidado manita, cuidado.

XD

mr.furia dijo...

que mal plan, yo nunca puedo dormir tengo un serio problema de insomnio.

Saludos